View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6921_low_15 (Length: 250)
Name: NF6921_low_15
Description: NF6921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6921_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 90 - 239
Target Start/End: Complemental strand, 34046153 - 34046004
Alignment:
| Q |
90 |
ttaaataatcgatagagcacaacaaacatttgaatttgattttatccgtcggtatgctaaatggaaaggtcgctttgccggcattttatggtttgaacta |
189 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34046153 |
ttaaataatcgatagaccacaacaaacatttgaatttgattgtatccgtcggtatgctgaatggaaaggtcgctttgccggcattttatggtttgaacta |
34046054 |
T |
 |
| Q |
190 |
agtaaccatcatttttgaataattgattgacaatgtcaattcgttttctt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34046053 |
agtaaccatcatttttgaataattgattgacaatgtcaattctttttctt |
34046004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University