View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6922_high_13 (Length: 284)
Name: NF6922_high_13
Description: NF6922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6922_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 248; Significance: 1e-138; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 18 - 273
Target Start/End: Original strand, 2302548 - 2302803
Alignment:
| Q |
18 |
taaatatggaaaatacttaattgttaaagttaaggcatggatgaagaattagttgatgacagaattcagttagatgctgttgaggattcacagcgtcaga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2302548 |
taaatatggaaaatacttaattgttaaagttaaggcatggatgaagaattagttgatgacagaattcagttagaggctgttgaggattcacagcgtcaga |
2302647 |
T |
 |
| Q |
118 |
acaaagacgacgtcctcgtaaaatcccaatatgatggtaaaaatgtagttgaagcagcagatacatcacaacatcaatatgaaacagttgaagaattaac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2302648 |
acaaagacgacgtcctcgtaaaatcccaatatgatggtaaaaatgtagttgaagcagcagatacatcacaacatcaatatgaaacagttgaagaattaac |
2302747 |
T |
 |
| Q |
218 |
agtgaaaagttacaatggttttagttttgatattggtacttctactacacaggttc |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2302748 |
agtgaaaagttacaatggttttagttttgatattggtacttctactacacaagttc |
2302803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 179 - 252
Target Start/End: Original strand, 2300851 - 2300924
Alignment:
| Q |
179 |
tacatcacaacatcaatatgaaacagttgaagaattaacagtgaaaagttacaatggttttagttttgatattg |
252 |
Q |
| |
|
|||||||||||||| ||||| || ||| |||||| |||| || |||||||| |||| || ||||||||||||| |
|
|
| T |
2300851 |
tacatcacaacatccatatgcaatagtcgaagaactaacggtaaaaagttataatgattcaagttttgatattg |
2300924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University