View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6922_high_18 (Length: 239)
Name: NF6922_high_18
Description: NF6922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6922_high_18 |
 |  |
|
| [»] scaffold0188 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0188 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: scaffold0188
Description:
Target: scaffold0188; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 18 - 201
Target Start/End: Original strand, 8316 - 8500
Alignment:
| Q |
18 |
atagtgatgtttttagggttcctcctggttataatgctcctcaacaggtatttt-tctatttatccaattttgaattgattcatggaagaaaggatatat |
116 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8316 |
atagcgatgtttttagggttccacctggttataatgctcctcaacaggtattttttctatttatccaattttgaattgattcatggaagaagggatatat |
8415 |
T |
 |
| Q |
117 |
gtttttaaatcacggcgtgacgnnnnnnnnnnnnnngtattatagaaaaattgcagttaaaatgcaggtttaattgtcgttgcat |
201 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8416 |
gtttttaaatcacggcgtgtcgttttttgtttttttgtattatagaaaaattgcagttaaaatgcaggtttaattgtcgttgcat |
8500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 18 - 75
Target Start/End: Original strand, 13636644 - 13636701
Alignment:
| Q |
18 |
atagtgatgtttttagggttcctcctggttataatgctcctcaacaggtatttttcta |
75 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
13636644 |
atagtgatgtttttgatgttccttctggttataatgctccccaacaggtatttttcta |
13636701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 18 - 66
Target Start/End: Complemental strand, 50981664 - 50981616
Alignment:
| Q |
18 |
atagtgatgtttttagggttcctcctggttataatgctcctcaacaggt |
66 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||| |||||||| |
|
|
| T |
50981664 |
atagtgatgtttttgctgttccttctggttataatgctccccaacaggt |
50981616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University