View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6922_low_1 (Length: 485)
Name: NF6922_low_1
Description: NF6922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6922_low_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 436; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 436; E-Value: 0
Query Start/End: Original strand, 21 - 480
Target Start/End: Original strand, 52183152 - 52183611
Alignment:
| Q |
21 |
accggctgcaacttcgacggtgctggtaacgggaattgcatcaccggagactgcactggaggattgaaatgcaatggtggaggtgctcctccagtgacgt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52183152 |
accggctgcaacttcgacggtgctggtaacgggaattgcatcaccggagactgcaccggaggattgaaatgcaatggtggaggtgctcctccagtgacgt |
52183251 |
T |
|
| Q |
121 |
tggcggaatttacgatcggaagcgtgagtggagataaagacttctatgacgttagtttggtggatggttacaatgtcgggatagggatacaagcaaccag |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52183252 |
tggcggaatttacgatcggaagcgtgagtggagataaagacttctatgacgttagtttggtggatggttacaatgtcgggatagggatacaagcaaccag |
52183351 |
T |
|
| Q |
221 |
aggaacaggtgattgtcagtatgcaggttgtgttgcagatttgaaaagtcattgtccagcggagttgcaggtaacagaggtagggggttcggtggtggcc |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52183352 |
aggaacaggtgattgtcagtatgcaggttgtgttgcggatttgaacagtcattgtccagcggagttgcaggtaacagaggtagggggttcggtggtggcc |
52183451 |
T |
|
| Q |
321 |
tgtaagagtgcgtgtgcagcgtttaaaaccgaggaattttgttgcaccggtgaacattcgagtccacagagttgcagtccaacacagtactcagagatgt |
420 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
52183452 |
tgtaagagtgcgtgtgcagcgtttaataccgaggaattttgttgtaccggtgaacattcgagtccacagagttgcagttcaacacagtactcagagatgt |
52183551 |
T |
|
| Q |
421 |
tcaagtctgcgtgtccctctgcgtacagttatgcttatgatgatgcttcaagcacttgca |
480 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52183552 |
tcaagtctgcgtgtccctctgcgtacagttatgcttatgatgatgcttcaagcacttgca |
52183611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000007; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 439 - 480
Target Start/End: Original strand, 6679300 - 6679341
Alignment:
| Q |
439 |
ctgcgtacagttatgcttatgatgatgcttcaagcacttgca |
480 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6679300 |
ctgcttacagttatgcttatgatgatgcttctagcacttgca |
6679341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 306 - 370
Target Start/End: Original strand, 6679167 - 6679231
Alignment:
| Q |
306 |
ggttcggtggtggcctgtaagagtgcgtgtgcagcgtttaaaaccgaggaattttgttgcaccgg |
370 |
Q |
| |
|
|||||||||||||| |||||||| |||||| ||||| || | |||||||||||||||||||| |
|
|
| T |
6679167 |
ggttcggtggtggcttgtaagagcgcgtgtttggcgttcaatatggaggaattttgttgcaccgg |
6679231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University