View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6923_high_6 (Length: 267)
Name: NF6923_high_6
Description: NF6923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6923_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 253
Target Start/End: Complemental strand, 47802887 - 47802635
Alignment:
| Q |
1 |
aggatatacccaagggcaaggccattcaaatcattcctagttcaccaagaaaggcacaaacacatccacaacattgttaatgtatgttgatgatgtaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47802887 |
aggatatacccaagggcaaggccattcaaatcattcctagttcaccaagaaaggcacaaatacatccacaacattgttaatgtatgttgatgatgtaatt |
47802788 |
T |
|
| Q |
101 |
caagatggtaaattatttgaatgaatttgcacatatcaaagccattatggatgaatttttcaaaactaaagacattggttcattgaactactttttggga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47802787 |
caagatggtaaattatttgaatgaatttgcacatatcaaagccattatggatgaatttttcaaaactaaagacattggttcattgaactactttttggga |
47802688 |
T |
|
| Q |
201 |
ttagaggtagcaagaacacaaaagggaattttattgtgccaacgcaaatattg |
253 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
47802687 |
ttggaggtagcaagaacacaaaagggaattttattgtgccaacgcagatattg |
47802635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University