View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6923_low_6 (Length: 276)
Name: NF6923_low_6
Description: NF6923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6923_low_6 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 115 - 276
Target Start/End: Complemental strand, 47803036 - 47802875
Alignment:
| Q |
115 |
cttacatcaacttgatgaaaataatgtatttctggtgattcttgagggagtgtcatgctataaatctaatcaagttattgaaaccattttatggccttaa |
214 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
47803036 |
cttacatcaatttgatgaaaataatgtgtttctggtgattcttgagggagtgtcatgctataaatctaatcaagttattgaaaccattttatggccttga |
47802937 |
T |
 |
| Q |
215 |
ataagctagcaaaatggtatgagaaattgacttcatctcttatagttcaaggatatacccaa |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47802936 |
ataagctagcaaaatggtatgagaaattgacttcatctcttatagttcaaggatatacccaa |
47802875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 1 - 122
Target Start/End: Complemental strand, 47803731 - 47803610
Alignment:
| Q |
1 |
aatcatgtttactttgtggttttacaaggcgagagagttacacaattattttcaagtgatgattccaaaattctcgttaatggttctagatttacttgct |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47803731 |
aatcatgtttactttgtggttttgcaaggcgagagagttacacaatcattttcaagtgatgattccaaaattctcgttaatggttctagatttacttgct |
47803632 |
T |
 |
| Q |
101 |
atcaataactcgtacttacatc |
122 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
47803631 |
atcaataactcgtacttacatc |
47803610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University