View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6924_high_3 (Length: 279)
Name: NF6924_high_3
Description: NF6924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6924_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 18 - 265
Target Start/End: Complemental strand, 36616440 - 36616193
Alignment:
| Q |
18 |
actttctacttcaaaactcatcaacggccaaagttaacatcttataacaacttattagtgcatgatgaagagtttatccaacctagctagcttgttattc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36616440 |
actttctacttcaaaactcatcaacggccaaagttaacatctcataacaacttattagtgcatgatgaagagtttatccaacctagctagcgtgttattc |
36616341 |
T |
 |
| Q |
118 |
tttatagttgaccaatcatggattatctttatgatctaggcactcttgttttggttaaattttgagttccttaattttagttgagtaatgttgagatatg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36616340 |
tttatagttgaccaatcatggattatctttatgatttaggcactcttgttttggttaaattttgagttccttaattttagttgagtaatgttgagatatg |
36616241 |
T |
 |
| Q |
218 |
tctactgcatgggtttctatttggaaaacatgttattagattgaggtt |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36616240 |
tctactgcatgggtttctatttggaaaacatgttattagattgaggtt |
36616193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 233 - 265
Target Start/End: Complemental strand, 33842720 - 33842688
Alignment:
| Q |
233 |
tctatttggaaaacatgttattagattgaggtt |
265 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
33842720 |
tctatttggaaaacatattattagattgaggtt |
33842688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University