View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6924_high_4 (Length: 256)
Name: NF6924_high_4
Description: NF6924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6924_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 2 - 238
Target Start/End: Complemental strand, 40780635 - 40780399
Alignment:
| Q |
2 |
tattagtttgtgcattattgctataaattattaatagaaaaaatagccatttggattatttataatgtaactannnnnnnnattagctagttgattgtaa |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40780635 |
tattagtttgtgcattattgctataaattattaatagaaaaaatagccatttggattatttataatgtaactattttttttattagctagttgattgtaa |
40780536 |
T |
|
| Q |
102 |
tgaacagttctgattttttggcattgattcaccaatttatcttttagaaattctttctctcttgaaaacgaaatttattgttgaactttcttttgccagt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40780535 |
tgaacagttctgattttttggcattgattcaccgatatatcttttagaaattctctctctcttgaaaacgaaatttattgttgaactttcttttgccagt |
40780436 |
T |
|
| Q |
202 |
gttttatatcagaatgttttgatttgttaggacaatt |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40780435 |
gttttatatcagaatgttttgatttgttaggacaatt |
40780399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University