View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6924_low_2 (Length: 620)
Name: NF6924_low_2
Description: NF6924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6924_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 39; Significance: 0.0000000000009; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 227 - 273
Target Start/End: Complemental strand, 8521875 - 8521829
Alignment:
| Q |
227 |
gatcatttacccattttacaagaaattttacaattttataagaatct |
273 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8521875 |
gatcatttacagattttacaagaaattttacaattttataagaatct |
8521829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 75 - 113
Target Start/End: Complemental strand, 8521968 - 8521930
Alignment:
| Q |
75 |
aatagacatggtaagtgtgatatttacatgattagttag |
113 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8521968 |
aatagacatgataagtgtgatatttacatgattagttag |
8521930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 537 - 604
Target Start/End: Complemental strand, 20069894 - 20069823
Alignment:
| Q |
537 |
cgtcattccccttgacagattgcttgtttttgagc----cttcagctattctcttttcttcgtagttgatgt |
604 |
Q |
| |
|
||||||| |||||| |||||||||||||||| ||| ||||| |||||||||||||||| |||||||||| |
|
|
| T |
20069894 |
cgtcatttcccttgccagattgcttgttttttagcacctcttcaactattctcttttcttcatagttgatgt |
20069823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University