View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6924_low_4 (Length: 350)
Name: NF6924_low_4
Description: NF6924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6924_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 16 - 315
Target Start/End: Complemental strand, 34711976 - 34711683
Alignment:
| Q |
16 |
caatataattggcgttacatgcaccatgcttaattggagatttagtggactttgnnnnnnnnnnnnaccaagcatttagtggactttgttaactagcact |
115 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||| ||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
34711976 |
caatataattggcgttaca-gcaccatgcttaattagagatttattggactttgttttttttt---aacaagcatttagtggactttgttaactagcact |
34711881 |
T |
|
| Q |
116 |
aaggagaaaatactcagcactttggtggtaattcaattgctgcataattttgcatttgattttgacnnnnnnnnnnnnngcaaaaatatacaccgtagaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34711880 |
aaggagaaaatactcagcactttggtggtaattcaattgctgcataattttgcatttgattttgacttttttttt----gcaaaaatatacaccgtagaa |
34711785 |
T |
|
| Q |
216 |
aagaatggcta--atgtaatggacctcatgggtggttttcggtgattaaataatggattttgctcatctcactaaaatgataataacaattggtcataaa |
313 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34711784 |
aagaatggctataatgcaatggacctcatgggtggttttcggtgattaaataatggattttgctcatctcactaaaatgataataacaattggtcataaa |
34711685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 302 - 334
Target Start/End: Complemental strand, 34711541 - 34711509
Alignment:
| Q |
302 |
attggtcataaaatactctttataataacacag |
334 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
34711541 |
attggtcataaaatactctttataataacacag |
34711509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University