View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6924_low_7 (Length: 256)

Name: NF6924_low_7
Description: NF6924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6924_low_7
NF6924_low_7
[»] chr4 (1 HSPs)
chr4 (2-238)||(40780399-40780635)


Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 2 - 238
Target Start/End: Complemental strand, 40780635 - 40780399
Alignment:
2 tattagtttgtgcattattgctataaattattaatagaaaaaatagccatttggattatttataatgtaactannnnnnnnattagctagttgattgtaa 101  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||    
40780635 tattagtttgtgcattattgctataaattattaatagaaaaaatagccatttggattatttataatgtaactattttttttattagctagttgattgtaa 40780536  T
102 tgaacagttctgattttttggcattgattcaccaatttatcttttagaaattctttctctcttgaaaacgaaatttattgttgaactttcttttgccagt 201  Q
    ||||||||||||||||||||||||||||||||| || ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
40780535 tgaacagttctgattttttggcattgattcaccgatatatcttttagaaattctctctctcttgaaaacgaaatttattgttgaactttcttttgccagt 40780436  T
202 gttttatatcagaatgttttgatttgttaggacaatt 238  Q
    |||||||||||||||||||||||||||||||||||||    
40780435 gttttatatcagaatgttttgatttgttaggacaatt 40780399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University