View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6925_low_2 (Length: 216)

Name: NF6925_low_2
Description: NF6925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6925_low_2
NF6925_low_2
[»] chr2 (2 HSPs)
chr2 (136-209)||(3894913-3894986)
chr2 (1-68)||(3895045-3895112)


Alignment Details
Target: chr2 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 136 - 209
Target Start/End: Complemental strand, 3894986 - 3894913
Alignment:
136 tggctttctcccacattgaacctgcagcatcttttgtcttctcatttgtatcacgtgcaaattgtttgatgtcc 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3894986 tggctttctcccacattgaacctgcagcatcttttgtcttctcatttgtatcacgtgcaaattgtttgatgtcc 3894913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 3895112 - 3895045
Alignment:
1 cttctctggctttatcccacacagaacctgctgcttcattggttctgtcttttacctcataagcatag 68  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3895112 cttctctggctttatcccacacagaacctgctgcttcattggttctgtcttttacctcataagcatag 3895045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University