View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6925_low_3 (Length: 244)
Name: NF6925_low_3
Description: NF6925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6925_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 16 - 228
Target Start/End: Original strand, 23747454 - 23747666
Alignment:
| Q |
16 |
atcacatagtagcactagcacgtttcttgttggccctattttccttgatcttaatgtttagtgttagtgactcaattctcactaaattctattatagctg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
23747454 |
atcacatagtagcactagcacgtttcttgttggccctattttccttgatcttaatgtttagtgttagtgattcaattctcactaaattctattatagctg |
23747553 |
T |
 |
| Q |
116 |
tttattgatttattaagtaccaaatagtatagtttgtataagggtttattaatgcnnnnnnnnncattgtcttgtccttgttctcaatgtagagtacatc |
215 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
23747554 |
ttgattgatttattaagtaccaaatagtatagtttgtataagggtttattaatgctttttttttcattgtcttgtccttgttctcaatgtagagtacatc |
23747653 |
T |
 |
| Q |
216 |
tgtaagggaaatg |
228 |
Q |
| |
|
|||||||||||| |
|
|
| T |
23747654 |
agtaagggaaatg |
23747666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University