View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6926_high_11 (Length: 334)
Name: NF6926_high_11
Description: NF6926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6926_high_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 8e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 8e-86
Query Start/End: Original strand, 1 - 321
Target Start/End: Complemental strand, 32824792 - 32824472
Alignment:
| Q |
1 |
agttttgtggattgtcaccttcatgtcaagaagaggtttagtttctttgtttgtggttcccatcccctatt----gaaaaatgatagcgagtgtgtttgt |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
32824792 |
agttttgtggattgtcaccttcatgtcaagaagaggtttagtttctttgtttgtggttcccatcccctatctatcgaaaaattatagcgagtgtgtttgt |
32824693 |
T |
|
| Q |
97 |
gtttttgttgggtccttnnnnnnnnnnnnnnnngttggtgtgatattgagatcagtgacaaagctagcataagnnnnnnnnnnnnnnnn--gaaagaaaa |
194 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32824692 |
gtttttgttgggtcctttatatatata------gttggtgcgatattgagatcagtgacaaagctagcataagttttttttttttttttttgaaagaaaa |
32824599 |
T |
|
| Q |
195 |
gctagcataaaatttagaatggggtttatcaaaaacattaagatggggtcaaatatcatcaattctatacctatctataaaagggattttatgacttgnn |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32824598 |
gctagcataaaatttagaatggggtttatcaaaaacattaagatggggtcaaatatcatcaattctatacgtatctataaaagggattttatgacttgaa |
32824499 |
T |
|
| Q |
295 |
nnnnngaagaaggggttttatgatgtc |
321 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
32824498 |
aaaaagaagaaggggttttatgatgtc |
32824472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University