View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6926_high_12 (Length: 326)
Name: NF6926_high_12
Description: NF6926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6926_high_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 28 - 313
Target Start/End: Complemental strand, 40512564 - 40512279
Alignment:
| Q |
28 |
cttcagataacgtaaaatttatgagtgcacccttagactagggtctatattagggggacttgttattaattgactattacatgattggtctaatatgggg |
127 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| | |||||| || |||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
40512564 |
cttcagataacgtaaaatgtatgagtgcacccttagactagggccaatattaaggtgacttgttattaattgactattacatcattggtctaatacgggg |
40512465 |
T |
 |
| Q |
128 |
tgatatttagcatgagaaagtgataaacatccccaccatgaccaagttgctttttaacctttagatcacataaggaacaaagttttatcatagtccttcc |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40512464 |
tgatatttagcatgagaaagtgataaacatccccaccatgtccaagttgctttttaacctgtagatcacataacgaacaaagttttatcatagtccttcc |
40512365 |
T |
 |
| Q |
228 |
acaatagactattttttaaatcatcttccaacaccattcttcaattgtgtatcttttctcaaaaggccaaaacaatctgcacacag |
313 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
40512364 |
acaatggactattttttaaatcatcttccaacaccattcttcaattgtgtaccttttctcaaaagaccaaaacaatctgcacacag |
40512279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University