View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6926_high_19 (Length: 217)
Name: NF6926_high_19
Description: NF6926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6926_high_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 13 - 167
Target Start/End: Original strand, 29229290 - 29229444
Alignment:
| Q |
13 |
tggacatcacagaaacagagcgcgctttaaatacggggcagacaatagagtcagccactttcgtcaaggacattgtcacccctcccttcttagggccctt |
112 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29229290 |
tggacattacagaaacagagcgcgctttaaatacggggcagacaatagagtcagccactttcgtcaaggacattgtcacccctcccttcttagggccctt |
29229389 |
T |
|
| Q |
113 |
aacaaagccatgatgtgaaagctcagtcacttatattatattcatctctctttct |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29229390 |
aacaaagccatgatgtgaaagctcagtcacttatattatattcatctctctttct |
29229444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University