View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6926_high_8 (Length: 349)
Name: NF6926_high_8
Description: NF6926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6926_high_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 318
Target Start/End: Complemental strand, 31763257 - 31762947
Alignment:
| Q |
1 |
ataaaagcaaaccaaagtaatcggaaaaagaagaaagcgaaacctggaatttctcactgtttctggctgccggaaactaactccggatgcgttttccgac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
31763257 |
ataaaagcaaaccaaagtaatcggaaaaagaagaaagcgaaacctggaatttctcactgtttctggctgccggaaactaactccggctgcgttttccgac |
31763158 |
T |
|
| Q |
101 |
gagcnnnnnnnnnnnnnnnnnnccggcgaaatgagttcagtgcattcaaacttgtttctgctgtaagaagcggtagcggtagcggnnnnnnnnnnnnnng |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
31763157 |
gagcttttttttttttttttc-ccggcgaaatgagttcagtgcattcaaacttgtttctgctgtaagaagcggtagcggt------tttttttatttttg |
31763065 |
T |
|
| Q |
201 |
aaaaaatagattgggctttttatctcaaattttaatgatagtagaattcggagattttcttatcgcaccctccatccctctcacgcaccctccaaaatta |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31763064 |
aaaaaatagattgggctttttatctcaaattttaatgatagtagaattcggagattttcttattccaccctccatccctctcacgcaccctccaaaatta |
31762965 |
T |
|
| Q |
301 |
ttattttatccgttcaaa |
318 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
31762964 |
ttattttatccgttcaaa |
31762947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 132 - 167
Target Start/End: Original strand, 32696520 - 32696555
Alignment:
| Q |
132 |
tgagttcagtgcattcaaacttgtttctgctgtaag |
167 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32696520 |
tgagttcagtgcattcaaacatgtttctgctgtaag |
32696555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University