View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6926_low_16 (Length: 278)
Name: NF6926_low_16
Description: NF6926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6926_low_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 15 - 271
Target Start/End: Complemental strand, 31763521 - 31763265
Alignment:
| Q |
15 |
ctttgaacatgaagttagcaaagaacgaatagcaaacttgaaggacttgttcagagtggagaacctagatccaattgcagtagcagttgttgttgatgaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31763521 |
ctttgaacatgaagttagcaaagaacgaatagcaaacttgaaggacttgttcagagtggagaacctagatccaattgcagtagcagttgttgttgatgaa |
31763422 |
T |
|
| Q |
115 |
gatgatgcatcattggaaccaattgcaacacttttctccattctctaaaaatttaattgaaatctttctttgtagtgattaattcaagcaataatgtagc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
31763421 |
gatgatgcatcattggaaccaattgcaacacttttctccattctctaaaaatttaattgaaatcttcctttgtagtgatgaattcaagcaataatgtagc |
31763322 |
T |
|
| Q |
215 |
aacctgggaaaccgtgtttttgaattaggttttaacacgataatatttaactccata |
271 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31763321 |
aacctgggaaatcgtgtttttgaattaggttttaacacgataatatttaactccata |
31763265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University