View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6926_low_21 (Length: 217)

Name: NF6926_low_21
Description: NF6926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6926_low_21
NF6926_low_21
[»] chr3 (1 HSPs)
chr3 (13-167)||(29229290-29229444)


Alignment Details
Target: chr3 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 13 - 167
Target Start/End: Original strand, 29229290 - 29229444
Alignment:
13 tggacatcacagaaacagagcgcgctttaaatacggggcagacaatagagtcagccactttcgtcaaggacattgtcacccctcccttcttagggccctt 112  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29229290 tggacattacagaaacagagcgcgctttaaatacggggcagacaatagagtcagccactttcgtcaaggacattgtcacccctcccttcttagggccctt 29229389  T
113 aacaaagccatgatgtgaaagctcagtcacttatattatattcatctctctttct 167  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29229390 aacaaagccatgatgtgaaagctcagtcacttatattatattcatctctctttct 29229444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University