View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6926_low_3 (Length: 503)
Name: NF6926_low_3
Description: NF6926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6926_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 206 - 499
Target Start/End: Original strand, 17196414 - 17196707
Alignment:
| Q |
206 |
ccctaaccggcaagagagagaaggccaaacgaggttatgattagcgagccaatcataaagaacaggaacaagagatttccattgagagtacttctcatca |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17196414 |
ccctaaccggcaagagagagaaggccaaacgaggttatgattagcaagccaatcataaagaacaggaacaagagatttccattgagagtacttctcatca |
17196513 |
T |
|
| Q |
306 |
acagaagcttgttgttgctgctgctgatgaagctgttgctgttgcttttccttcttcgattctctcggtgtcttcacttgtgatggttcttctctcttgt |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
17196514 |
acagaagcttgttgttgctgctgctgatgaagctgttgctgttgcttttccttcttcgattctctcggtgacttcacttgtgatggttcttctctcttgt |
17196613 |
T |
|
| Q |
406 |
cttccttgggtttaggtttgcgtcctcttgtctccttcttcttcacggcgccggttgagggtggtgtctccatttctcacgctctctgctactc |
499 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
17196614 |
cttccttgggtttaggtttgcgtcctcttgtctccttcttcttcacggcgccggttgagggtggtgtctccatttctcactctctgtgctactc |
17196707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University