View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6927_low_25 (Length: 253)
Name: NF6927_low_25
Description: NF6927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6927_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 5 - 240
Target Start/End: Complemental strand, 27698474 - 27698232
Alignment:
| Q |
5 |
attgatctctttatagcaaagagagaaataaggattagtgttgttgttgtaacctagagtttttgttctattattaagtgagggagtgaaataaaactaa |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27698474 |
attgatctctttatagcaaagagagaaataaggattagtgttgttgttgtaacctagagtttttgttctattattaagtgagggagtgaaataaaactaa |
27698375 |
T |
 |
| Q |
105 |
aagggggcagggggca-------aaggtattataggactagatattcataaattttgaaacatttattatatgaatgtcattgtctttggtctattttac |
197 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
27698374 |
aagggggcagggggcagggggcaaaggtattataggactagatattcataaattttgaaacatttattatatgaatgtcattgtctttgttctattttac |
27698275 |
T |
 |
| Q |
198 |
aattggttattaaaatatttgtgtttttgaaattttttcacag |
240 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
27698274 |
aattggttattaaaatatttgtgtttctgaaattttttcacag |
27698232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University