View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6927_low_29 (Length: 243)
Name: NF6927_low_29
Description: NF6927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6927_low_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 1e-59; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 85 - 225
Target Start/End: Original strand, 12629108 - 12629247
Alignment:
| Q |
85 |
agaaatgattatatcgtgaaaaatatttgtttaaggtgaaaaaatattgtaaactaatttttataaaatcgatatttgtttcacctgaaagtttaatatt |
184 |
Q |
| |
|
|||||||| ||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12629108 |
agaaatgagtattttgtgaaaaatatttgtttaaggtgaaaaaatattgtaaactaatttttataaaatcgatatttgtttcacctgaaagtttaatatt |
12629207 |
T |
 |
| Q |
185 |
ggtttgggggaatcaattacttaaggcaacattgaggctgt |
225 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
12629208 |
ggtttgggtgaatcaattacttaa-gcaacattgaggctgt |
12629247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 124 - 192
Target Start/End: Original strand, 12623195 - 12623263
Alignment:
| Q |
124 |
aaaaatattgtaaactaatttttataaaatcgatatttgtttcacctgaaagtttaatattggtttggg |
192 |
Q |
| |
|
|||||||| |||| |||||| ||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12623195 |
aaaaatatcgtaatttaatttatataaaatcaatatttgtttcacctgaaagtttaatattggtttggg |
12623263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 12629024 - 12629068
Alignment:
| Q |
1 |
atgattttagtaagtcaaacagtcatgtttataattgaagttgat |
45 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
12629024 |
atgattttagtaggtcaaaaagtcatgtttataattgaagttgat |
12629068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University