View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6927_low_37 (Length: 218)
Name: NF6927_low_37
Description: NF6927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6927_low_37 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 14 - 199
Target Start/End: Original strand, 6962416 - 6962600
Alignment:
| Q |
14 |
tgggatgaagagtaagaaacaagttccatatgggctactgcttttccactgttgaataatctgacnnnnnnngtgactgttgtaataatatgtaatgtat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
6962416 |
tgggatgaagagtaagaaacaagttccatatgggctactgcttttccactgttgaataatctgactttttt-gtgactgttgtaataatatataatgtat |
6962514 |
T |
|
| Q |
114 |
tcataatatgggaaataggatgtgttattgaggatttggttttggaattcaataagagaattgtaatttagggtctacatggaaac |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6962515 |
tcataatatgggaaataggatgtgttattgaggatttggttttgatattcaataagagaattgtaatttagggtctacatggaaac |
6962600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University