View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6927_low_7 (Length: 512)
Name: NF6927_low_7
Description: NF6927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6927_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 456; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 456; E-Value: 0
Query Start/End: Original strand, 1 - 495
Target Start/End: Complemental strand, 42341833 - 42341336
Alignment:
| Q |
1 |
tcaaccatcctctttcttcctcgtaaaccattcatatcaatcccaaattgaccacccgagttttcatttccaatcccatccgatgaaaccggactaacag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42341833 |
tcaaccatcctctttcttcctcgtaaaccattcatatcaatcccaaattgaccacccgagttttcgtttccaatcccatccgatgaaaccggactaacag |
42341734 |
T |
 |
| Q |
101 |
gtccacccattcccatagtttgtgccactgccatgccataaccgcccgctgctccattcaccactctccctccgtaacaaacagctggcggcggtggagg |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
42341733 |
gtccgcccattcccatagtttgtgccactgccacgccataaccgcccgctgctccattcaccactctccctccgtaacaaatagctggcggcggcggagg |
42341634 |
T |
 |
| Q |
201 |
ataccccgtacctatactatctctcgtcttaccattcccaacataccctgaactcgaaggttctccaactgctccacctccctgtgccaccgtttggtac |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42341633 |
ataccccgtacctatactatctctcgtcttaccattcccaacataccctgaactcgaaggttctccaactgctccacctccctgtgccaccgtttggtac |
42341534 |
T |
 |
| Q |
301 |
ggtggcgcaacaacgtttagattcccgccgccgccaatagcaaatgaagcagcctgaaccattgtagagttgttgttcggatacactgcagcgtaatgct |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42341533 |
ggtggcgcaacaacgtttagattcccgccgccgccaatagcaaatgaagcagcctgagccattgtagagttgttgttcggatacactgcggcgtaatgct |
42341434 |
T |
 |
| Q |
401 |
g---ctgcggccggtgagatgacactgctgctgcggtaggtggtggtgctatggcaaccggcataccagactgttgttccctaactacccctgcttta |
495 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42341433 |
gctgctgcggccggtgagatgacactgctgctgcggtaggtggtggtgctatggcaaccggcataccagactgttgttccctaactacccctgcttta |
42341336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University