View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6928_low_9 (Length: 225)

Name: NF6928_low_9
Description: NF6928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6928_low_9
NF6928_low_9
[»] chr5 (1 HSPs)
chr5 (75-215)||(20150782-20150919)
[»] chr2 (1 HSPs)
chr2 (90-168)||(12083323-12083402)
[»] chr8 (1 HSPs)
chr8 (88-166)||(38817958-38818036)


Alignment Details
Target: chr5 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 75 - 215
Target Start/End: Original strand, 20150782 - 20150919
Alignment:
75 agtgactaaagattattatgacgaactagaacttgaaatatcctcgttgttgataggaacattgtttcaatcttttgttgtaaatttttgagagcaggtg 174  Q
    |||||||||||||||||| ||||||||||| ||||||||||||| ||||| ||   ||||||||||||||||||||||||||||||||||||||||||||    
20150782 agtgactaaagattattacgacgaactagaccttgaaatatccttgttgtcga---gaacattgtttcaatcttttgttgtaaatttttgagagcaggtg 20150878  T
175 tttccatccagatgtttagatgaattttaatctcttgatgt 215  Q
    |||||||||||||||||||||||||||||||||||||||||    
20150879 tttccatccagatgtttagatgaattttaatctcttgatgt 20150919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 90 - 168
Target Start/End: Original strand, 12083323 - 12083402
Alignment:
90 ttatgacgaactagaacttgaaatatcctcgttgttgat-aggaacattgtttcaatcttttgttgtaaatttttgagag 168  Q
    |||||| |||||||| |||||||||| || ||||| ||| ||||||||| ||| ||||||||||||||| || |||||||    
12083323 ttatgaagaactagaccttgaaatatacttgttgtagattaggaacattatttgaatcttttgttgtaatttcttgagag 12083402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 88 - 166
Target Start/End: Original strand, 38817958 - 38818036
Alignment:
88 tattatgacgaactagaacttgaaatatcctcgttgttgataggaacattgtttcaatcttttgttgtaaatttttgag 166  Q
    |||||||| |||||||| |||||||| |||| ||||  || ||||||||||||| |||||||||| |||| || |||||    
38817958 tattatgaagaactagaccttgaaatttccttgttggagaaaggaacattgtttgaatcttttgtagtaatttcttgag 38818036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University