View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6929_high_12 (Length: 204)
Name: NF6929_high_12
Description: NF6929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6929_high_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 169
Target Start/End: Original strand, 37134716 - 37134885
Alignment:
| Q |
1 |
ctgtaaataaatgaattgaaaaaatttaagttattgcagttttaaaatgaacaatgctatttatctagataaattttgtagcgaaaatgaattgtccaat |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37134716 |
ctgtaagtaaatgaattgaaaaaatttaagttattacagttttaaaatgagcaatgctatttatctagataaattttgtagcgaaaatgaattgtccaat |
37134815 |
T |
|
| Q |
101 |
aaaatagttttctgccacaaatcaaagaggtggtgagacataatttaaggaaaa-tccttttaaaattta |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
37134816 |
aaaatagttttctgccacaaatcaaagaggtggtgagacataatttaaggaaaattccttttaaaattta |
37134885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 79 - 155
Target Start/End: Complemental strand, 11207318 - 11207241
Alignment:
| Q |
79 |
tagcgaaaatgaattgtccaataaaatagttttctg-ccacaaatcaaagaggtggtgagacataatttaaggaaaat |
155 |
Q |
| |
|
|||||||||| || ||||||||||||| |||| ||| ||||||||||| | ||||||| | ||||||||||||||||| |
|
|
| T |
11207318 |
tagcgaaaattaagtgtccaataaaattgtttcctggccacaaatcaagggggtggtggggcataatttaaggaaaat |
11207241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University