View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6929_low_7 (Length: 302)
Name: NF6929_low_7
Description: NF6929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6929_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 9e-67; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 9e-67
Query Start/End: Original strand, 17 - 203
Target Start/End: Original strand, 44395227 - 44395405
Alignment:
| Q |
17 |
actttagctacggatatgatgttatgatatccgactatccgtagcacttgttgtccatacatggttagaaagcagtacaatgaaataactataatggcca |
116 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44395227 |
actttaactacggatatgatgttatgatatc--------cgtagcacttgttgtccatacatggttagaaagcagtacaatgaaataactataatggcca |
44395318 |
T |
|
| Q |
117 |
gagggaaaaccacatacgacaattacttggagaatgaaacgaaaatatacnnnnnnntattaagatcttgtaaaaataatatgcttc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44395319 |
gagggaaaaccacatacgacaattacttggagaatgaaacgacaatatacaaaaaaatattaagatcttgtaaaaataatatgcttc |
44395405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 255 - 295
Target Start/End: Original strand, 44395455 - 44395495
Alignment:
| Q |
255 |
ggggttagaagactatatgatccccattatcttttcttttc |
295 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44395455 |
ggggttagaagactatatgatccccagtatcttttcttttc |
44395495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University