View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6931_low_11 (Length: 207)
Name: NF6931_low_11
Description: NF6931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6931_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 21 - 193
Target Start/End: Complemental strand, 38931965 - 38931793
Alignment:
| Q |
21 |
agaaagcgtggtgataaagaagaagaaactaacaacatgttcagtggttttgattcacgtttcttgggacaagttttgaaagtgaaagaaagtataatta |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38931965 |
agaaagcgtggtgataaagaagaagaaactaacaacatgttcagtggttttgattcacgtttcttgggacaagttttgaaagtgaaagaaagtataatta |
38931866 |
T |
|
| Q |
121 |
gaaagcttcaatctccagatgaagaacatagaaagcaccaaattatacatgttaaaggaggtcttagtattat |
193 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38931865 |
gaaagcttcaatctcaagatgaacaacatagaaagcaccaaattatacatgttaaaggaggtcttagtattat |
38931793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University