View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6931_low_6 (Length: 348)
Name: NF6931_low_6
Description: NF6931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6931_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 18 - 267
Target Start/End: Complemental strand, 45875048 - 45874803
Alignment:
| Q |
18 |
gagacaaatatgggaagttagtagaagaaaagatataggaagttgaagtttagtgggagaaaaatatggaagatatcaaataaagttaagtacgggtcct |
117 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45875048 |
gagacaaatatgggaagttagtaga------gatataggaagttgaagtttagtgggagaaaaatatggaagatatcaaataaagtcaagtacgggtcct |
45874955 |
T |
|
| Q |
118 |
taatcttttgttgaaattaaaactgcatagccgccttaactaaaccctatatatttattagttagtactctctctcaccaatcaa--tttatcatatcac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | |||| | ||||||||||||| |
|
|
| T |
45874954 |
taatcttttgttgaaattaaaactgcatagccgccttaactaaaccctatatatttattagttagtactctcaccaatcaatttatctttatcatatcac |
45874855 |
T |
|
| Q |
216 |
tcccacgaactcgcaactcataactcaatcgctcgacttgcaaggtatacta |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45874854 |
tcccacgaactcgcaactcataactcaatcgctcgacttgcaaggtatacta |
45874803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University