View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6932_low_17 (Length: 256)
Name: NF6932_low_17
Description: NF6932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6932_low_17 |
 | |
|
| [»] scaffold0153 (3 HSPs) |
| | |
|
Alignment Details
Target: scaffold0153 (Bit Score: 239; Significance: 1e-132; HSPs: 3)
Name: scaffold0153
Description:
Target: scaffold0153; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 35567 - 35329
Alignment:
| Q |
1 |
acagcgattacaaatataaacagggatgaatcaaaccctaaaacccccaatttcaatctcaccctcaatgtgaatctcaatcctgtttggttaaactact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35567 |
acagcgattacaaatataaacagggatgaatcaaaccctaaaacccccaatttcaatctcaccctcaatgtgaatctcaatcctgtttggttaaactact |
35468 |
T |
|
| Q |
101 |
tcgagttcagagcgttggatggaggagcgaggggtgtaggagaggttggtgatgagtttatcgggttggcggaagttttcaatccagagattggagatga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35467 |
tcgagttcagagcgttggatggaggagcgaggggtgtaggagaggttggtgatgagtttatcgggttggcggaagttttcaatccagagattggagatga |
35368 |
T |
|
| Q |
201 |
gggagaaagcgtcttccttgaggagggtggaagggtcgt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35367 |
gggagaaagcgtcttccttgaggagggtggaagggtcgt |
35329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0153; HSP #2
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 132 - 239
Target Start/End: Complemental strand, 27230 - 27123
Alignment:
| Q |
132 |
gggtgtaggagaggttggtgatgagtttatcgggttggcggaagttttcaatccagagattggagatgagggagaaagcgtcttccttgaggagggtgga |
231 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
27230 |
gggtggaggagaggttggtgatgagtttatcgggttggcggaagttttcgatccagagattggagatgagcgagaaagcgtcttccttaaggagggtgga |
27131 |
T |
|
| Q |
232 |
agggtcgt |
239 |
Q |
| |
|
|||||||| |
|
|
| T |
27130 |
agggtcgt |
27123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0153; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 100 - 141
Target Start/End: Complemental strand, 27331 - 27290
Alignment:
| Q |
100 |
ttcgagttcagagcgttggatggaggagcgaggggtgtagga |
141 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27331 |
ttcgagttcagagcgttggatggaggaccgaggggtgtagga |
27290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 99; Significance: 6e-49; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 1 - 99
Target Start/End: Original strand, 51271599 - 51271697
Alignment:
| Q |
1 |
acagcgattacaaatataaacagggatgaatcaaaccctaaaacccccaatttcaatctcaccctcaatgtgaatctcaatcctgtttggttaaactac |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51271599 |
acagcgattacaaatataaacagggatgaatcaaaccctaaaacccccaatttcaatctcaccctcaatgtgaatctcaatcctgtttggttaaactac |
51271697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 132 - 238
Target Start/End: Complemental strand, 1165576 - 1165470
Alignment:
| Q |
132 |
gggtgtaggagaggttggtgatgagtttatcgggttggcggaagttttcaatccagagattggagatgagggagaaagcgtcttccttgaggagggtgga |
231 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1165576 |
gggtggaggagaggttggtgatgagtttatcgggttggcggaagttatcaatccagagattggagatgagggagaaagcgtcttccttgaggagggtgga |
1165477 |
T |
|
| Q |
232 |
agggtcg |
238 |
Q |
| |
|
||||||| |
|
|
| T |
1165476 |
agggtcg |
1165470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 104 - 141
Target Start/End: Complemental strand, 1165673 - 1165636
Alignment:
| Q |
104 |
agttcagagcgttggatggaggagcgaggggtgtagga |
141 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1165673 |
agttcagagcgttggatggaggagcgaggagtgtagga |
1165636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 10 - 91
Target Start/End: Original strand, 22775059 - 22775140
Alignment:
| Q |
10 |
acaaatataaacagggatgaatcaaaccctaaaacccccaatttcaatctcaccctcaatgtgaatctcaatcctgtttggt |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22775059 |
acaaatataaacagggatgaatcaaaccctaaaacccccaatttcaatctcaccctcaatgtgaatctcaatcctgtttggt |
22775140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University