View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6932_low_21 (Length: 203)
Name: NF6932_low_21
Description: NF6932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6932_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 16 - 190
Target Start/End: Complemental strand, 26462179 - 26462005
Alignment:
| Q |
16 |
ttcgtgttgaccgaacagtgccgtgtggctcaagcgaaggcgataaaacaacgatgtttagatcagttgcactgtttttattgtttactgctttggattc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
26462179 |
ttcgtgttgaccgaacagtgccgtgtggctcaagcgaaggcgataaaacaacgatgtttagatcagttgcactgtttttattgtttactactttggattc |
26462080 |
T |
 |
| Q |
116 |
atgatacacgctagggtgtgtcatgtcagggatagtaatggtaacggcttcaccggcgcgtgaggttgtttcatg |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
26462079 |
atgatacacgctagggtgtgtcatgtcagggatagtaatggtaacggcttcaccagcgcgtgacgttgtttcatg |
26462005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 119; Significance: 5e-61; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 16 - 190
Target Start/End: Original strand, 38005634 - 38005808
Alignment:
| Q |
16 |
ttcgtgttgaccgaacagtgccgtgtggctcaagcgaaggcgataaaacaacgatgtttagatcagttgcactgtttttattgtttactgctttggattc |
115 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| ||||||||| |||||||||| |||| |
|
|
| T |
38005634 |
ttcgtgttgatcgaacagtgccgtgtggctcaagcgaaggtgataaaacaacgatgtttagatcagtcgcaccgtttttatttactactgctttgaattc |
38005733 |
T |
 |
| Q |
116 |
atgatacacgctagggtgtgtcatgtcagggatagtaatggtaacggcttcaccggcgcgtgaggttgtttcatg |
190 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||| ||||| |||||||||||||||||| |||||||||| |
|
|
| T |
38005734 |
atgatacacgctagggtgtgacatatcagggatagtaactgtaacagcttcaccggcgcgtgagtttgtttcatg |
38005808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University