View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6933_low_2 (Length: 350)
Name: NF6933_low_2
Description: NF6933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6933_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 1 - 332
Target Start/End: Complemental strand, 35805911 - 35805580
Alignment:
| Q |
1 |
accaccatcaaaattgtgataaatataaatctccaccacgcaattgcatatgaatttattaatgtaaattaagaggctagtttgtaaattaagaggctag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35805911 |
accaccatcaaaattgtgataaatataaatctccaccacgcaattgcatatgaatttattaatgtaaattaagaggctagtttgtaaattaagaggctag |
35805812 |
T |
 |
| Q |
101 |
ttagaattgaagttaaacaacaccacttgctggccttgtccacaacatgaagaccactcaaggtagccatgagggttgctttcaaatgtctcatgagata |
200 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35805811 |
ttagaattgaagtgaaacaacaccacttgttggccttgtccacaacatgaagaccactcaaggtagccatgagggttgctttcaaatgtctcatgagata |
35805712 |
T |
 |
| Q |
201 |
tatgtactattcaccaccaccggtgcttacataattcccccaccactgccaccgtggacccttggcttccaccctcaatttcatcatttagggttttgat |
300 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35805711 |
tatgtacgattcaccaccaccggtgcttacataattcccccaccactgccaccgtggacccttggcttccaccctcaatttcatcatttagggttttgat |
35805612 |
T |
 |
| Q |
301 |
ctaactatctgcaaagggaatcgatccatatt |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
35805611 |
ctaactatctgcaaagggaatcgatccatatt |
35805580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University