View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6934_low_4 (Length: 342)
Name: NF6934_low_4
Description: NF6934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6934_low_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 10 - 328
Target Start/End: Complemental strand, 25192930 - 25192612
Alignment:
| Q |
10 |
aacctgtggactttcctaaggtttgttccatgtagaagcagtagctttctgtctagaaataaaaggcgatggtgctaactgataagagagaggaactgca |
109 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25192930 |
aaccagtggactttcctaaggtttgttccatgtagaagcagtagctttctgtctagaaataaaaggcgatggtgctaactgataagagagaggaactgca |
25192831 |
T |
|
| Q |
110 |
tcaagaaatggctgttggtggtctgtagtctgtacaaatggtaaaacctactgatatattttggctacacagaaatttatacttatgatgtgtatgtcta |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
25192830 |
tcaagaaatggctgttggtggtctgtagtctgtacaaatggtaaaacctactgatatattttggctacacagaaatttatacttatgatgtgtatgttta |
25192731 |
T |
|
| Q |
210 |
aatgcttagcattgcaagtttcctttgaacttattttagcgttgggttgttgccattggttgatttattgtctttatatcgttgttatacattaactttg |
309 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25192730 |
aatgcttagcattgcaagtttcctttgagcttattttagcgttgggttgttgccattggttgatttattgtctttatatcgttgttatacattaactttg |
25192631 |
T |
|
| Q |
310 |
gcaaatgtgctcctgatgt |
328 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
25192630 |
gcaaatgtgctcctgatgt |
25192612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University