View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6934_low_5 (Length: 332)
Name: NF6934_low_5
Description: NF6934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6934_low_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 171; Significance: 8e-92; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 171; E-Value: 8e-92
Query Start/End: Original strand, 103 - 320
Target Start/End: Original strand, 10021770 - 10021990
Alignment:
| Q |
103 |
ttatgcttgtttggcaagaaattgaggggttgatgaatttggtgaatgtggttttttggattaagggagagattttggtgttgtttgtgtgtgagttgtg |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
10021770 |
ttatgcttgtttggcaagaaattgaggggttgatgaatttggtgaatgtggttttttggattaagagagagattttggtgttttttgtgtgtgagttgtg |
10021869 |
T |
 |
| Q |
203 |
ctgcattgtagttgcatattggtgatg---gttaatgttggttgatatttcatggtttggtgcaaaatttgagatgtttttgttatgaaattggtgttgg |
299 |
Q |
| |
|
|||||||||||||| |||| ||||||| | |||||||||||||||||||| ||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
10021870 |
ctgcattgtagttgtatataggtgatggatggtaatgttggttgatatttcacggtttggtgcaaaatttgagatgtttttgttcttaaattggtgttgg |
10021969 |
T |
 |
| Q |
300 |
tttttgtttaaggtttgatgt |
320 |
Q |
| |
|
||| ||||||||||||||||| |
|
|
| T |
10021970 |
tttatgtttaaggtttgatgt |
10021990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University