View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6934_low_8 (Length: 289)
Name: NF6934_low_8
Description: NF6934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6934_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 7e-89; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 101 - 274
Target Start/End: Complemental strand, 47362135 - 47361962
Alignment:
| Q |
101 |
tccagcgaacagaggttacgaacggtgcagcggaggacggtggtggagggatggggaaagcagagagaagttgcattgaccgtgtgtcgacgatggagat |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47362135 |
tccagcgaacggaggttacgaacggtgcagcggaggacggtggtggagggatggggaaagcagagagaagttgcattgaccgtgtgtcgacgatggagat |
47362036 |
T |
|
| Q |
201 |
tgaactgccggaagggaatgcgaggaggccgttggggtttagatctgaggatccgaaattgttgcggcttgatg |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
47362035 |
tgaactgccggaagggaatgcgaggaggccgttggggtttagatctgaggatccgaagttgttgcggcttgatg |
47361962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 31
Target Start/End: Complemental strand, 47362235 - 47362205
Alignment:
| Q |
1 |
tcaagaagagcaatgcgaccttgacgatcgc |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
47362235 |
tcaagaagagcaatgcgaccttgacgatcgc |
47362205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University