View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6936_low_15 (Length: 248)
Name: NF6936_low_15
Description: NF6936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6936_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 16 - 225
Target Start/End: Original strand, 4903199 - 4903408
Alignment:
| Q |
16 |
aagaatatgaacagccttattggacaagataatgcttcttctgctgccaacaccatcaacaggtcagaaaactattgttttacggtgattgttaacttgt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
4903199 |
aagaatatgaacagccttattggacaagataatggttcttctgctgccaacaccatcaacaggtcagaaaactattgttttactgtgattgtttacttgt |
4903298 |
T |
|
| Q |
116 |
taaattttgttaaaattaactttcttgaataagaaaaataccctatagtactaattagagtgtcacaaggctttttcaaagcccgcgactacgatttgag |
215 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4903299 |
taaattttgttaaaattaactttcttgaaaaagaaaaataccctatagtactaattagagtgtcacaaggctttttcaaagcctgcgactacgatttgag |
4903398 |
T |
|
| Q |
216 |
ccgtgacatc |
225 |
Q |
| |
|
|||||||||| |
|
|
| T |
4903399 |
ccgtgacatc |
4903408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University