View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6936_low_16 (Length: 246)

Name: NF6936_low_16
Description: NF6936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6936_low_16
NF6936_low_16
[»] chr1 (1 HSPs)
chr1 (1-226)||(8451858-8452081)


Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 8451858 - 8452081
Alignment:
1 tattatatcttacaatatattcagtgagcagaggtgaaacaagggacacacaaatgtggcatacctcgagtttctgcattttctttgtcacttcatgctt 100  Q
    |||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8451858 tattatatcttataatatattcagtgagcagaggtgtaacaagggacacacaaatgtggcatacctcgagtttctgcattttctttgtcacttcatgctt 8451957  T
101 gaggctctcaatatcctataaaaatgcatgcgtgaagattaatcaagtaacttatttattacgaagtaattc--aaaataaaaagtagagcgaaaaagaa 198  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    |||||||||||||||||  |||| |||||||||||||||||||||    
8451958 gaggctctcaatatcctataaaaatgcatgcgtgaagattaatcaagtaac----ttattacgaagtaattcaaaaaaaaaaaagtagagcgaaaaagaa 8452053  T
199 tttgtatagtacattctgacgaagtcta 226  Q
    |||||||||||||||||| |||||||||    
8452054 tttgtatagtacattctgtcgaagtcta 8452081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University