View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6936_low_20 (Length: 231)
Name: NF6936_low_20
Description: NF6936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6936_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 18 - 219
Target Start/End: Original strand, 53088309 - 53088510
Alignment:
| Q |
18 |
aaaagatacatgaaaaataagttttatcatcaaataacattgcaatatacatatatacatgtgagccagttttatcactaaataagactccaatataaaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
53088309 |
aaaagatacatgaaaaataagttttatcatcaaataacattgcaatatacatatatacatgtgagccagttttatcactaaataatactccaatataaaa |
53088408 |
T |
 |
| Q |
118 |
ttacagattgatgtctgcttgcagagttgcagtaaatgaattttatgttaataataataagacatcaaaactattgtatggatatggcgatcctttgcac |
217 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
53088409 |
ttacatattgatgtctgcttgcagagttgcagtaaatgaattttatgttaataataataagacttcaaagctattgtatggatatggcgatcctttgcac |
53088508 |
T |
 |
| Q |
218 |
ag |
219 |
Q |
| |
|
|| |
|
|
| T |
53088509 |
ag |
53088510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University