View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6936_low_22 (Length: 224)
Name: NF6936_low_22
Description: NF6936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6936_low_22 |
 |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 18779708 - 18779913
Alignment:
| Q |
1 |
gttctacgtctggaaacacatgataccttactaggaagcaacaaacacattagtgacaagatcgaaacactcattaatagattggaagtgcaagtagcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18779708 |
gttctacgtctggaaacacatgataccttactaggaagcaacaaacacattagtgacaagatcgaaacactcattaatagattggaagtgcaagtagcaa |
18779807 |
T |
 |
| Q |
101 |
agttgtcaatcaattgtgtaagttgcaacttttatgagcaagctcattcaaattgtagcatttgtcctttaacttgtcgcaaaatcattccaaacttaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18779808 |
agttgtcaatcaattgtgtaagttgcaacttttatgagcaagctcattcaaattgtagcatttgtcctttaacttgtcgcaaaatcattccaaacttaaa |
18779907 |
T |
 |
| Q |
201 |
tggtag |
206 |
Q |
| |
|
|||||| |
|
|
| T |
18779908 |
tggtag |
18779913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 92 - 145
Target Start/End: Original strand, 19292432 - 19292485
Alignment:
| Q |
92 |
aagtagcaaagttgtcaatcaattgtgtaagttgcaacttttatgagcaagctc |
145 |
Q |
| |
|
|||||| |||||||||||||||| ||||||| || |||||||||||||||||| |
|
|
| T |
19292432 |
aagtagaaaagttgtcaatcaatggtgtaagatgggacttttatgagcaagctc |
19292485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 92 - 147
Target Start/End: Complemental strand, 20269 - 20214
Alignment:
| Q |
92 |
aagtagcaaagttgtcaatcaattgtgtaagttgcaacttttatgagcaagctcat |
147 |
Q |
| |
|
|||||| |||||| ||||||||| ||| |||||| ||||||| ||||||||||||| |
|
|
| T |
20269 |
aagtagtaaagttttcaatcaatggtggaagttgtaacttttgtgagcaagctcat |
20214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University