View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6936_low_24 (Length: 217)
Name: NF6936_low_24
Description: NF6936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6936_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 19 - 200
Target Start/End: Complemental strand, 47339595 - 47339414
Alignment:
| Q |
19 |
ttaagagcattagctatagcaattgctccttcgtcttccaagttcaggaagctcaggtatatctcttttaactctgcattcttggcaagagctttactca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
47339595 |
ttaagagcattagctatagcaattgctccttcgtcttccaagttcaggaagctcaggtatatctctcttaactctgcattcttggcaagagctttactca |
47339496 |
T |
 |
| Q |
119 |
gagaaaccccaccctctacacctaacatgttgtctcgcaaatcaagcttcctcaaatgggtgcaattccccaaagcatcaga |
200 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
47339495 |
gggaaaccccaccctctacacctaacatgttgtctcgcaaatcaagcttcctcaaatgggtgcaatcccccaaagcatcaga |
47339414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 110 - 183
Target Start/End: Complemental strand, 32062017 - 32061944
Alignment:
| Q |
110 |
ctttactcagagaaaccccaccctctacacctaacatgttgtctcgcaaatcaagcttcctcaaatgggtgcaa |
183 |
Q |
| |
|
||||||| |||| ||| ||| | || ||||| ||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
32062017 |
ctttacttagagcaactccagcttccacaccaaacatgttgtcacgcaaatcaagcttcttcaaatgcgtgcaa |
32061944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University