View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6936_low_3 (Length: 502)
Name: NF6936_low_3
Description: NF6936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6936_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 216 - 482
Target Start/End: Complemental strand, 42956095 - 42955828
Alignment:
| Q |
216 |
caggataattaattgtgcttacaatttaccaagatagtttttgcttatgttttttataaaagctgttgcgataacatctttgttcatttcagttataact |
315 |
Q |
| |
|
|||||| | |||||||| ||||||||||||||| ||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42956095 |
caggatcactaattgtgtttacaatttaccaagttagattttgcctatgttttttataaaagctgttgcgataacatctttgttcatttcagttataact |
42955996 |
T |
 |
| Q |
316 |
caatatcggttatatatgtcacggtttgttgaaatcatgaaatcagatggtattttttagactgaaagagagaaaataaagtgagtgaatctttgagctg |
415 |
Q |
| |
|
| |||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42955995 |
ctatatcggttatatatgtcacggcttgttgaaaacatgaaatcagatggtattttttagactgaatgagagaaaataaagtgagtgaatctttgagctg |
42955896 |
T |
 |
| Q |
416 |
agaaattgttgtatctctgcattcttttgatcaaat-aaatagaaagtgaggaagcagaatgtattgc |
482 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42955895 |
agaaattgttgtatctctgcattcttttgatcaaataaaatagaaagtgaggaagcagaatgtattgc |
42955828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 173; E-Value: 8e-93
Query Start/End: Original strand, 1 - 189
Target Start/End: Complemental strand, 42956281 - 42956093
Alignment:
| Q |
1 |
ttgtatgacggttacttgaagtgaagaaagttgttggtgaagacaatcgagctaacttgttaaccaaggtggttcctagatccaattttttgcattgctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42956281 |
ttgtatgacggttacttgaagtgaagaaagttgtcggtgaagacaatcgagctaacttgttaaccaaggtggttcccagatccaattttttgcattgctt |
42956182 |
T |
 |
| Q |
101 |
gaccggtaaatctagatacctgcgagagttgaattctcaaaagttgtgaacactttaggctatcactatcttcattcaatgtgtttcag |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
42956181 |
gaccggtaaatctagatacctgcgagagttgaattctcaaaagttgtgaacactttaggctatcactatcttaattcattgtgtttcag |
42956093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University