View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6937_high_3 (Length: 357)
Name: NF6937_high_3
Description: NF6937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6937_high_3 |
 |  |
|
| [»] scaffold0332 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0332 (Bit Score: 317; Significance: 1e-179; HSPs: 1)
Name: scaffold0332
Description:
Target: scaffold0332; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 1 - 347
Target Start/End: Original strand, 7025 - 7370
Alignment:
| Q |
1 |
cggaacttgtctagagcttttatcgtagacgaaatagtgaagtttacctcagctatagttgggaactcttatcatacctctatcaagaatggcttcaacg |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7025 |
cggaacttgtctagagcttttattgtagacgaaatagtgaagtttacctcagctatagttgggaactcttatcatacctctatcaagaatggcttcaacg |
7124 |
T |
 |
| Q |
101 |
acactaactccgatcacctgacgaggatttcttttaaggtaagacaatattttatcttggagtagtgttcagatcaacttcgtgtactagaatataattg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7125 |
acactaactccgatcacctgacgaggatttcttttaaggtaagacaatattttatcttggagtagtgttcagatcaacttcgtgtactagaatataattg |
7224 |
T |
 |
| Q |
201 |
gatttcaaaatgttgtatccaaaattactatttttcatatcacagccctttgatttaacttttaagacatgnnnnnnncacatcaataaagccctcattt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7225 |
gatttcaaaatgttgtatccaaaattactatttttcatatcacagccctttgatttaacttttaagacatg-aaaaaacacatcaataaagccctcattt |
7323 |
T |
 |
| Q |
301 |
caagaaatacctttttcttcatgtttgattaacctaattttcttcga |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7324 |
caagaaatacctttttcttcatgtttgattaacctaattttcttcga |
7370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University