View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6937_low_6 (Length: 264)
Name: NF6937_low_6
Description: NF6937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6937_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 10 - 245
Target Start/End: Original strand, 52374632 - 52374867
Alignment:
| Q |
10 |
gacatcaacggaatggaggttcgatcacttcctttcgttctttccttcaacaaccttacctatagtgttaagatacgtaataaaatgagtttcaccgact |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52374632 |
gacatcaacggaatggaggttcgatcacttcctttcgttctttccttcaacaaccttacctatagtgttaagatacgtaataaaatgagtttcaccgact |
52374731 |
T |
|
| Q |
110 |
tattctctcgccgccgtgcatctccggtcgctgagacgcctgcactcggggagacggcgttttcacggagtaagattctgctcaacgaaatctccggtga |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52374732 |
tattctctcgccgccgtgcatctccggtcgctgagacgcctgcactcggggagactgcgttttcacggagtaagattctgctcaacgaaatctccggtga |
52374831 |
T |
|
| Q |
210 |
agcacgtgacggtgagatcatggctttcctcggagc |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
52374832 |
agcacgtgacggtgagatcatggctttcctcggagc |
52374867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 181 - 233
Target Start/End: Complemental strand, 40384350 - 40384298
Alignment:
| Q |
181 |
aagattctgctcaacgaaatctccggtgaagcacgtgacggtgagatcatggc |
233 |
Q |
| |
|
|||||||| ||||| || ||||||||||||||| | |||||||| |||||||| |
|
|
| T |
40384350 |
aagattctcctcaatgatatctccggtgaagcaagagacggtgaaatcatggc |
40384298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University