View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6938_high_5 (Length: 223)
Name: NF6938_high_5
Description: NF6938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6938_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 55029941 - 55029727
Alignment:
| Q |
1 |
gatgttcttcttgctggcataggcaaggcaaggaggatgcaagttccaaatgtgaatatgcaacattgtgttggtacgaatctcattcatttggcttatt |
100 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| ||||||| |||||||||||||| |
|
|
| T |
55029941 |
gatgttcttcttgcaggcattggcaaggcaaggaggatgcaagttccaaatgtgaatatgcagcattatgttggtactaatctcactcatttggcttatt |
55029842 |
T |
 |
| Q |
101 |
tgaacgctaatctaaaaaattccctttttgttatatgtttgactgttttgcttcaaattttaccttccccaacgtagatctcaacat---atgaatcatt |
197 |
Q |
| |
|
|||| | |||||||||||| |||||||||| ||||||||| ||||||| ||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
55029841 |
cgaacacaaatctaaaaaatcccctttttgtggtatgtttgattgttttgtttcaaattttaccttccccaatttagatctcaacatcaaatgaatcatt |
55029742 |
T |
 |
| Q |
198 |
tttatttgatgtcca |
212 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
55029741 |
tttatttgatgtcca |
55029727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 50338198 - 50338300
Alignment:
| Q |
1 |
gatgttcttcttgctggcataggcaaggcaaggaggatgcaagttccaaatgtgaatatgcaacattgtgttggtacgaatctcattcatttggcttatt |
100 |
Q |
| |
|
||||||| || ||| |||||||||| ||| ||||||||||||||||||||||| |||||||| ||| ||||| |||| ||||||| |||||||||||| | |
|
|
| T |
50338198 |
gatgttcctcatgcaggcataggcagggcgaggaggatgcaagttccaaatgttaatatgcagcatagtgttagtactaatctcagtcatttggcttaat |
50338297 |
T |
 |
| Q |
101 |
tga |
103 |
Q |
| |
|
||| |
|
|
| T |
50338298 |
tga |
50338300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University