View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6939_high_12 (Length: 210)

Name: NF6939_high_12
Description: NF6939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6939_high_12
NF6939_high_12
[»] chr3 (1 HSPs)
chr3 (20-195)||(28683293-28683468)


Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 20 - 195
Target Start/End: Original strand, 28683293 - 28683468
Alignment:
20 ttccatgccatattggctcttctggagaggaggcaactttatgtttgttaagattcttttctggacaccgatagcttaaatgcatatgttctagattgct 119  Q
    |||||||||| |||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
28683293 ttccatgccacattgcctcttctagagaggaggcaactttatgtttgttaagattcttttctggacaccgatagcttaaatgcatatgttatagattgct 28683392  T
120 tgaaatctgtttgaaaatgatttaatatctgaaaacataattatttgtctttgttgggtctgatgccacgtctctg 195  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||    
28683393 tgaaatctgtttgaaaatgatttaatatctgaaaacataattatatgtcgttgttgggtctgatgccacgtctctg 28683468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University