View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6939_low_11 (Length: 254)
Name: NF6939_low_11
Description: NF6939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6939_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 19 - 238
Target Start/End: Original strand, 48141892 - 48142111
Alignment:
| Q |
19 |
tcattaccttgaacactataagtgctaatattggcattcatgtaaccaatgttggctacatgatcattcaaacagatgttaccaccatttgtattatgaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48141892 |
tcattaccttgaacactataagtgctaatattggcattcatgtaaccaatgttggctacatgatcattcaaacagatgttaccaccatttgtattatgaa |
48141991 |
T |
 |
| Q |
119 |
atatattgctagtatcagaaatggagctactttgtnnnnnnnnnnnnncatcagtgttactattatcagcattttgaggaaaatgtgaattactattcat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
48141992 |
atatattgctagtatcagaaatggagctactttgtaaaaaactaaaaacatcagtgttactattatcagcattttgaggaaaatgtgaactactattcat |
48142091 |
T |
 |
| Q |
219 |
gctcactattttggattcat |
238 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
48142092 |
gctcactattttggattcat |
48142111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University