View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6939_low_12 (Length: 250)
Name: NF6939_low_12
Description: NF6939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6939_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 180
Target Start/End: Complemental strand, 1767745 - 1767566
Alignment:
| Q |
1 |
ttcgggtatttttttataaaaatatgtttgccacacaatttaatatttctnnnnnnnnnnctatttttaaaacaaaaatgtacttaaaatttcatatgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1767745 |
ttcgggtatttttttataaaaatatgtttgccacacaatttaatatttctaaaaaaaaacctatttttaaaacaaaaatgtacttaaaatttcatatgaa |
1767646 |
T |
 |
| Q |
101 |
agcaaattattgcattctcactcgtaaataaattcatgcaaattatgaaagttatctcattattgaaaacttttataccc |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1767645 |
agcaaattattgcattctcactcgtaaataaattcatgcaaattatgaaagttatctcattattgaaaacttttataccc |
1767566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 203 - 246
Target Start/End: Complemental strand, 1767543 - 1767500
Alignment:
| Q |
203 |
taaccttataacaaaggtaggcataaatattagtattatctacc |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1767543 |
taaccttataacaaaggtaggcataaatattagtagtatctacc |
1767500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University