View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6939_low_6 (Length: 339)
Name: NF6939_low_6
Description: NF6939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6939_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 179 - 316
Target Start/End: Complemental strand, 9404182 - 9404045
Alignment:
| Q |
179 |
ctaacgtcaccagctttatgagcagcgtcgacagcagatgcgagaaattgagagtgtaaatctacacagttgagtgacgaatcaatcaatgagtgagtag |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9404182 |
ctaacgtcaccagctttatgagcagcgtcgacagcagatgcgagaaattgagagtgtaaatctacacagttgagtgacgaatcaatcaatgagtgagtag |
9404083 |
T |
|
| Q |
279 |
gtataataagatctccatactacaaactgaaacgagaa |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9404082 |
gtataataagatctccatactacaaactgaaacgagaa |
9404045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 9 - 84
Target Start/End: Complemental strand, 9404352 - 9404277
Alignment:
| Q |
9 |
gaagaatataggaaacaaaccgatcctttgtgttcgacgtgtttagtttgggagaatcctttgcgaataacctgat |
84 |
Q |
| |
|
|||||| || ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9404352 |
gaagaaaatgggaaacagaccgatcctttgtgttcgacgtgtttagtttgggagaatcctttgcgaataacctgat |
9404277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University