View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6940_high_29 (Length: 262)

Name: NF6940_high_29
Description: NF6940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6940_high_29
NF6940_high_29
[»] chr2 (1 HSPs)
chr2 (17-250)||(36912956-36913189)


Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 17 - 250
Target Start/End: Complemental strand, 36913189 - 36912956
Alignment:
17 aggtcggtagaaaacgagcttcttcccaaaggcagcttcatgaaatgaaattactaaagcttcgaactttatttcataaatgttgacatgacatatggtt 116  Q
    ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
36913189 aggtcagtagaaaacgaacttcttcccaaaggcagcttcatgaaatgaaattactaaagctacgaactttatttcataaatgttgacatgacatatggtt 36913090  T
117 aacacagtgttatgagtgggctcaaaatgatcaaaatacgcatgccatacatgaaaaattcaactatttagcgatgccctaaatctaatggggccatggc 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36913089 aacacagtgttatgagtgggctcaaaatgatcaaaatacgcatgccatacatgaaaaattcaactatttagcgatgccctaaatctaatggggccatggc 36912990  T
217 tgtctcagaatcatcatatttgatccttgattca 250  Q
    ||||||||||||||||||||||||||||||||||    
36912989 tgtctcagaatcatcatatttgatccttgattca 36912956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University