View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6940_high_36 (Length: 233)
Name: NF6940_high_36
Description: NF6940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6940_high_36 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 20 - 222
Target Start/End: Original strand, 29371144 - 29371347
Alignment:
| Q |
20 |
agaaacatatatttctttttcaaatttgtcattatctaaatttaaaatctgatatgcgcagtgtttgtaataatattatattgattgcaggagaagcttt |
119 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| || | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29371144 |
agaaacatatatttcttgttcaaatttgtcattatctaaatttaaaatctgatatgtgcggagtttgtaataatattatattgattgcaggagaagcttt |
29371243 |
T |
 |
| Q |
120 |
aaattattgctatggcaaatgtccacaagacaaaaacatttgtaatgtttcttgtttaaaacaattgaggtatcctaagggtggc-tctgtagtgacaca |
218 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
29371244 |
aaattattgttatggcaaatgtccacaagacaaaaacatttgtaatgtttcttgtttaaaacaattgaggtatcctaagggtggcttctgtagcgacact |
29371343 |
T |
 |
| Q |
219 |
ggtt |
222 |
Q |
| |
|
|||| |
|
|
| T |
29371344 |
ggtt |
29371347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University